Mapping Results View  


Search Parameter

More


Mapping Results

Termini: Linker:

Sequence Size: 23base

1_23


MS Match: 
U A G C U U A U C A G A C U G A U G U U G A C
RNADescriptionScoreCoverageMatchedSumMatched PositionsMatched Sequences
4920_1_23hsa-miR-21-5p MIMAT0000076 Homo sapiens miR-21-5p add3p:C10.9100111_23p_UAGCUUAUCAGACUGAUGUUGAC_OH

Matched Nucleotide List    

E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science