Mapping Results View  


Search Parameter

More


Mapping Results

Termini: Linker:

Sequence Size: 23base

1_23


MS Match: 
A U C A U A C A G G G A C A U C C A G U U U U
RNADescriptionScoreCoverageMatchedSumMatched PositionsMatched Sequences
37160_1_23hsa-miR-487a-3p MIMAT0002178 Homo sapiens miR-487a-3p del5p:A add3p:U add3p:U10.9100111_23p_AUCAUACAGGGACAUCCAGUUUU_OH

Matched Nucleotide List    

E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science