Results View


Search Parameter
Nucleotide Mapping

Score Histogram

Identification Summary

Oligonucleotide-RNA Matrix

MS/MS Ion Search

Matched Nucleotide List (overall)

Browse Search Log

Search Parameter

more


Nucleotide Mapping

Score Histogram


Identification Summary
RNADescScoreMatchedSumMatched_positionMatched_sequences
1_1Sce_25S_rRNA681.4721717292_5, 6_17, 19_21, 25_30, 31_33, 42_53, 57_59, 60_64, 65_74, 77_80, 81_86, 87_91, 99_101, 105_110, 111_120, 121_127, 129_136, 140_143, 146_148, 149_155, 159_161, 163_170, 174_176, 177_183, 184_189, 190_196, 198_202, 204_206, 213_215, 221_227, 235_237, 252_256, 259_264, 265_267, 275_277, 278_281, 284_287, 288_290, 291_297, 305_320, 321_330, 338_341, 342_345, 348_353, 354_358, 361_363, 365_368, 369_371, 372_376, 377_383, 384_388, 395_400, 407_412, 413_415, 416_419, 422_424, 427_432, 433_437, 446_450, 453_459, 460_466, 471_473, 477_483, 484_493, 496_499, 500_505, 506_510, 515_517, 519_530, 532_535, 536_538, 539_542, 543_547, 549_552, 561_564, 569_575, 576_579, 580_582, 589_591, 598_600, 601_604, 611_613, 614_616, 618_624, 633_635, 636_639, 640_644, 645_651, 653_658, 662_668, 669_674, 681_684, 689_701, 709_712, 715_718, 719_721, 723_725, 729_733, 734_737, 738_740, 743_750, 751_754, 755_760, 761_763, 771_773, 775_779, 782_785, 788_792, 793_795, 796_798, 801_809, 806_809, 810_812, 816_822, 823_826, 836_838, 839_842, 843_845, 858_860, 865_867, 865_869, 871_875, 876_878, 881_887, 888_891, 895_900, 913_916, 917_924, 925_934, 935_937, 938_940, 942_947, 948_950, 951_953, 965_968, 969_971, 972_974, 979_984, 985_991, 992_994, 995_999, 1002_1005, 1006_1010, 1011_1013, 1014_1018, 1025_1029, 1030_1035, 1036_1059, 1060_1063, 1064_1066, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1102_1104, 1107_1113, 1118_1126, 1128_1131, 1132_1134, 1135_1139, 1143_1145, 1150_1152, 1153_1157, 1158_1161, 1162_1164, 1167_1171, 1175_1177, 1175_1178, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1227_1229, 1227_1230, 1231_1233, 1238_1242, 1244_1246, 1251_1256, 1269_1281, 1283_1285, 1286_1289, 1290_1295, 1296_1300, 1308_1310, 1314_1319, 1341_1344, 1347_1349, 1350_1354, 1355_1357, 1358_1362, 1363_1365, 1368_1370, 1372_1374, 1381_1383, 1384_1387, 1390_1392, 1393_1395, 1396_1400, 1401_1404, 1405_1408, 1418_1421, 1423_1429, 1432_1434, 1435_1440, 1445_1447, 1448_1450, 1448_1464, 1467_1473, 1474_1476, 1481_1483, 1489_1492, 1494_1500, 1501_1507, 1508_1510, 1511_1513, 1515_1517, 1529_1536, 1539_1541, 1545_1547, 1548_1552, 1553_1560, 1562_1565, 1566_1573, 1574_1576, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1656_1658, 1669_1673, 1676_1678, 1701_1712, 1720_1727, 1731_1733, 1737_1743, 1745_1747, 1749_1751, 1752_1754, 1755_1758, 1759_1766, 1767_1769, 1771_1775, 1781_1784, 1787_1789, 1791_1794, 1797_1807, 1809_1811, 1818_1825, 1826_1829, 1839_1845, 1846_1848, 1849_1851, 1853_1860, 1864_1868, 1869_1875, 1876_1878, 1879_1882, 1883_1889, 1883_1892, 1890_1892, 1893_1897, 1900_1902, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1955_1957, 1960_1962, 1964_1968, 1970_1973, 1974_1976, 1977_1979, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2043_2045, 2046_2048, 2049_2051, 2053_2057, 2059_2061, 2063_2069, 2070_2072, 2073_2076, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2125_2130, 2135_2150, 2151_2155, 2158_2160, 2162_2165, 2166_2169, 2172_2174, 2175_2177, 2178_2180, 2181_2185, 2188_2194, 2195_2199, 2202_2206, 2207_2210, 2211_2216, 2219_2221, 2219_2234, 2222_2234, 2241_2246, 2254_2261, 2262_2272, 2274_2276, 2277_2283, 2284_2288, 2284_2300, 2303_2305, 2312_2315, 2326_2335, 2336_2353, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2383_2385, 2386_2391, 2397_2400, 2401_2403, 2404_2409, 2410_2412, 2415_2418, 2419_2425, 2426_2429, 2430_2435, 2438_2440, 2449_2451, 2455_2457, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2523_2525, 2531_2533, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2577_2579, 2580_2584, 2587_2589, 2590_2592, 2593_2598, 2599_2602, 2611_2614, 2616_2618, 2625_2632, 2633_2639, 2640_2645, 2646_2648, 2649_2651, 2664_2669, 2673_2677, 2678_2687, 2688_2690, 2691_2698, 2701_2706, 2707_2714, 2721_2728, 2733_2745, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2779_2784, 2785_2787, 2788_2794, 2792_2794, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2832_2834, 2842_2848, 2851_2856, 2857_2863, 2864_2871, 2872_2874, 2896_2898, 2899_2901, 2902_2907, 2909_2912, 2915_2917, 2919_2922, 2919_2937, 2940_2943, 2948_2950, 2958_2961, 2969_2972, 2978_2990, 2991_2993, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3029_3031, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3063_3065, 3066_3069, 3070_3074, 3076_3080, 3081_3083, 3086_3088, 3089_3098, 3099_3101, 3103_3108, 3110_3112, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3174_3176, 3178_3182, 3183_3188, 3192_3197, 3206_3208, 3209_3216, 3217_3219, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3261_3263, 3272_3276, 3277_3284, 3292_3303, 3316_3318, 3319_3325, 3334_3337, 3338_3340, 3341_3343, 3346_3348, 3349_3353, 3354_3356, 3357_3361, 3362_3366, 3367_3369, 3372_3377, 3378_3383, 3384_3386, 3387_3390, 3391_3395UUUG, ACCUCAAAUCAG, UAG, UACCCG, CUG, CAUAUCAAUAAG, AGG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, AAG, CAAAAG, CUCAAAUUUG, AAAUCUG, UACCUUCG, CCCG, UUG, UAAUUUG, AGG, CAACUUUG, CCG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, ACG, AGG, AAUCCCG, AGG, UAAAG, CCUUCG, AAG, UUG, UUUG, AAUG, CAG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, ACCG, AUAG, AACAAG, UACAG, AUG, AAAG, AUG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, UUG, AAAG, AAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, UAG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, CAG, AUAAAUCCAUAG, AAUG, UAG, CUUG, CCUCG, UAAG, CCUG, AAUACUG, CCAG, CUG, AGG, ACG, UAAG, AUG, CUG, CAUAAUG, CCG, CCCG, UCUUG, AAACACG, ACCAAG, UCUAACG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, UAG, UUG, CCUCG, CAAG, AGG, CACAAUCG, ACCG, AUCCUG, AUG, AUG, AUUUG, UAAG, CAUAG, CUG, UUG, ACCCGAAAG, AAAG, AUG, AACUAUG, CCUG, AAG, CCAG, AGG, AGG, UAG, UAGCG, UUCUG, ACG, CAAAUCG, AUCG, AAUUUG, AAAG, ACUAAUCG, AACCAUCUAG, UAG, CUG, UUCCUG, CCG, AAG, AUAG, CAG, AAG, UAUCAG, UUUUAUG, AGG, UAAAG, AAUG, AUUAG, AGG, UUCCG, AAAUG, ACCUUG, ACCUAUUCUCAAACUUUAAAUAUG, UAAG, AAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, AAG, CUUUUAG, CCAUUUUUG, UAAG, CAG, AACUG, AUG, AUG, AACCG, AACG, UAG, UUAAG, CCG, CCGG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, CCG, CCGG, ACG, CCAUG, AAG, AAUCCG, UAACAACUCACCG, CCG, AAUG, AACUAG, CCCUG, AUG, CUCAAG, UCAG, UUG, AUAUG, AUG, CCCUG, ACG, UAG, CAG, AGG, UCAG, ACG, AAG, CCUAG, ACCG, UAAG, AACG, CCUCUAG, CAG, AUCUUG, UAG, UAG, UAGCAAAUAUUCAAAUG, AACUUUG, AAG, AAG, AAAG, UUCCACG, UCAACAG, CAG, UUG, ACG, AUCCUAAG, AUG, AAG, CUCCG, UUUCAAAG, CCUG, AUUUUAUG, CAG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, ACG, CCCUG, AGG, CUUAUCACCCCG, UUUAUCCG, AUG, UCUUAUG, CUG, AAG, AGG, CCAG, CACCUUUG, CUG, CUCCG, CUUG, ACG, CCCG, AAAAUCCACAG, AAG, UUUUCAUG, CCAG, AUAACCG, CAG, CAG, UCUCCAAG, AACAG, CCUCUAG, UUG, AUAG, AAUAAUG, AAUAAUGUAG, UAG, AUAAG, AAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, UAG, AGG, CCUUG, UCAG, ACG, CAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, UUG, UAG, ACG, CCUUG, UAG, UCUCUUG, UAG, ACCG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, AAUCUG, UCUAAUUAAAACAUAG, CAUUG, AUG, UCAG, AAAG, AUG, UUG, ACG, CAAUG, AUUUCUG, CCCAG, CUCUG, AAUG, UCAAAG, AAG, AAGAAAUUCAACCAAG, AAAUUCAACCAAG, UAAACG, UAACUAUG, ACUCUCUUAAG, UAG, CCAAAUG, CCUCG, CCUCGUCAUCUAAUUAG, ACG, AAUG, AUUCCCACUG, UCCCUAUCUACUAUCUAG, AAACCACAG, CCAAG, AACG, CUUG, CAG, AAUCAG, AAAG, AAG, ACCCUG, UUG, CUUG, ACUCUAG, UUUG, ACAUUG, AAG, AGG, UAG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAG, CUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, CUG, AUCCG, UUG, AAG, ACAUUG, UCAG, UUUG, CUG, CACAUCUG, UUAAACG, AUAACG, CAG, AUG, CUCAUG, AACAG, AAAUCUCCAG, UAG, AACAAAAG, UAAAAG, CCCCCUUG, AUUUUCAG, AAUACAAACCAUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, AAUUUG, AGG, CUAGAGG, AGG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, CAG, UUCAUAG, ACAUUG, CUUUUUG, AUUCUUCG, AUG, AAG, CAG, AAUUCG, UAAG, UUG, AUUG, AUUGUUCACCCACUAAUAG, AACG, CUG, ACCG, ACAG, UUUUACCCUACUG, AUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AGG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, CUG, UCUG, AUCAG, CAUUG, CCG, AAG, CUACCAUCCG, CUG, AUUAUG, CUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUG, AUACG, AAUAAG, UCCUUG, CUG, AACCAUAG, CAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, AUG, UACAACG, UAAG, CAG, UAG, UAG, CCUUG, UUG, UUACG, AUCUG, CUG, AUUAAG, CCUUUG, UUG, UCUG, AUUUG
0_211Sce_18S_rRNA35.901589880_885, 896_899, 900_902, 923_925, 939_942, 943_948, 949_953, 955_957, 973_976, 977_980, 988_991, 992_994, 995_997, 998_1002, 1012_1014, 1033_1035, 1036_1040, 1043_1046CAUCAG, UCAG, AGG, AAG, AAAG, CAUUUG, CCAAG, ACG, AACG, AAAG, AUCG, AAG, AUG, AUCAG, UAG, CCG, ACUAG, AUCG
0_2Sce_18S_rRNA27.317248_10, 11_16, 17_20, 21_23, 31_34, 43_48, 49_53UUG, AUCCUG, CCAG, UAG, CUUG, AUUAAG, CCAUG
0_390Sce_18S_rRNA25.9412741537_1539, 1543_1546, 1549_1553, 1573_1575, 1585_1588, 1591_1594, 1602_1605, 1608_1610, 1611_1616, 1639_1642, 1655_1658, 1659_1662CUG, AUAG, CAUUG, AGG, UAAG, CAAG, CUUG, UUG, AUUACG, CCCG, AUUG, AAUG
0_111Sce_18S_rRNA25.2714100499_503, 504_509, 511_514, 538_540, 550_552, 554_557, 558_561, 565_568, 569_571, 572_574, 608_610, 611_613, 614_616, 629_631, 632_634, 635_641, 644_647, 649_651, 653_655, 653_656UCUUG, UAAUUG, AAUG, AGG, AGG, CAAG, UCUG, CCAG, CAG, CCG, UUG, UUG, CAG, UAG, UUG, AACUUUG, CCCG, UUG, CCG, CCGG
0_321Sce_18S_rRNA21.7112801289_1291, 1300_1304, 1305_1308, 1319_1324, 1325_1328, 1359_1364, 1365_1367, 1384_1386, 1403_1405, 1406_1408, 1410_1412, 1413_1416, 1417_1419UUG, AUUUG, UCUG, AUAACG, AACG, CAUUUG, CUG, AGG, CCG, AUG, AAG, UUUG, AGG
0_358Sce_18S_rRNA16.215201430_1433, 1436_1438, 1446_1448, 1449_1453, 1456_1458UCUG, AUG, ACG, UUCUG, CCG
0_48Sce_18S_rRNA16.021075275_279, 282_284, 288_290, 323_325, 327_329, 331_334, 358_362, 366_371, 378_383, 387_389, 393_396CCUUG, CUG, AUG, AUG, UAG, AUAG, UAACG, AAUAAG, AUUCCG, AGG, CCUG
0_371Sce_18S_rRNA11.915281475_1477, 1481_1484, 1500_1502, 1505_1507, 1508_1512ACG, CCAG, CCG, AGG, UCUUG
0_302Sce_18S_rRNA9.92251230_1233, 1234_1237, 1238_1241AUUG, ACAG, AUUG
0_191Sce_18S_rRNA8.93311817_819, 820_823, 835_837ACG, UUUG, UUG
0_272Sce_18S_rRNA8.37251123_1126, 1128_1130CAAG, CUG
0_100Sce_18S_rRNA7.1824460_462, 463_465AGG, UAG
0_422Sce_18S_rRNA6.75291671_1673, 1681_1685AGG, AUCUG
0_278Sce_18S_rRNA6.43251147_1149, 1151_1153ACG, AAG
0_35Sce_18S_rRNA6.1125197_199, 202_204AAG, AUG
0_167Sce_18S_rRNA6.0511715_720UCCUUG
0_262Sce_18S_rRNA6.05111103_1107UUCUG
0_439Sce_18S_rRNA6.05111721_1726AAUUUG
0_289Sce_18S_rRNA5.54111173_1176CCUG
0_23Sce_18S_rRNA5.3611124_127AUAG
0_90Sce_18S_rRNA5.2827420_422, 424_426, 427_429AAG, CAG, CAG
0_18Sce_18S_rRNA4.671192_95AAUG
0_319Sce_18S_rRNA4.51111279_1281CCG
0_444Sce_18S_rRNA4.29111746_1748AGG
0_204Sce_18S_rRNA4.2111869_871ACG
0_180Sce_18S_rRNA4.0611773_775CAG
0_43Sce_18S_rRNA3.8911244_246AUG
0_451Sce_18S_rRNA3.89111775_1777UAG
0_429Sce_18S_rRNA3.72111693_1695AAG
0_457Sce_18S_rRNA3.72111790_1792AAG

Oligonucleotide-RNA Matrix
 RNA1_10_2110_20_3900_1110_3210_3580_480_3710_3020_1910_2720_1000_4220_2780_350_1670_2620_4390_2890_230_900_180_3190_4440_2040_1800_430_4510_4290_457
 Rank12345678910111213141516171717202122232425262728283030
 Score681.4735.9027.3125.9425.2721.7116.2116.0211.919.928.938.377.186.756.436.116.056.056.055.545.365.284.674.514.294.214.063.893.893.723.72
 Length339416746126158131291223812218615786564410433333333
OligonucleotideQuery12345678910111213141516171717202122232425262728283030
UAG2120110100100001000000000000000100
AGG28318101220110001100000000001000000
CCG2087100211010000000000000010000000
AUG2719100011200000001000000000001000
AAG11,19,28923200010000000011000001000000011
CAUUUG731100010000000000000000000000000
AACG128100010000000000000000000000000
ACG8013100001010100010000000000100000
AAAG411200000000000000000000000000000
AUCAG72100000000000000000000000000000
CAUCAG991100000000000000000000000000000
AUCG1221200000000000000000000000000000
UCAG156100000000000000000000000000000
CCAAG1051100000000000000000000000000000
UUG31,51815011410000100000000000000000000
CUUG1,109,51710011000000000000000000000000000
CCAG167010100010000000000000000000000
AUCCUG661010000000000000000000000000000
CCAUG1001010000000000000000000000000000
AUUAAG1481010000000000000000000000000000
CAAG1581001100000010000000000000000000
AAUG99001100000000000000000100000000
CCCG283001100000000000000000000000000
CUG13,40717001010100010000000000000000000
AUAG153,543001000100000000000010000000000
AUUG503001000002000000000000000000000
UAAG28001000000000000000000000000000
CAUUG3142001000000000000000000000000000
UCUG522000111000000000000000000000000
UCUUG711000100010000000000000000000000
CAG32,330,36117000200000000000000002000010000
AACUUUG622000100000000000000000000000000
CCGG4062000100000000000000000000000000
UAAUUG971000100000000000000000000000000
UUUG175000010000100000000000000000000
AUUUG832000010000000000000000000000000
AUAACG1111000010000000000000000000000000
UUCUG1081000001000000000010000000000000
CCUG643000000100000000000100000000000
UAACG342000000100000000000000000000000
AUUCCG871000000100000000000000000000000
CCUUG246,55000000100000000000000000000000
AAUAAG602000000100000000000000000000000
ACAG652000000001000000000000000000000
AUCUG1811000000000000100000000000000000
AAUUUG1352000000000000000001000000000000
UCCUUG18,3032000000000000000100000000000000
ACCUCAAAUCAG2361000000000000000000000000000000
UACCCG1261000000000000000000000000000000
CAUAUCAAUAAG218,5051000000000000000000000000000000
AAAAG224000000000000000000000000000000
AAACCAACCG257,396,4571000000000000000000000000000000
CCUUAG1161000000000000000000000000000000
CAAAAG1241000000000000000000000000000000
CUCAAAUUUG1821000000000000000000000000000000
AAAUCUG351000000000000000000000000000000
UACCUUCG2021000000000000000000000000000000
UAAUUUG591000000000000000000000000000000
CAACUUUG121,2651000000000000000000000000000000
UUCCUUG432000000000000000000000000000000
UCUAUG332000000000000000000000000000000
AACAG25,2594000000000000000000000000000000
AAUCCCG1601000000000000000000000000000000
UAAAG472000000000000000000000000000000
CCUUCG125,4491000000000000000000000000000000
CUCUAAG26,2672000000000000000000000000000000
UAAAUUCCAUCUAAAG334,4001000000000000000000000000000000
CUAAAUAUUG1901000000000000000000000000000000
ACCG10,243,2715000000000000000000000000000000
AACAAG1541000000000000000000000000000000
UACAG1071000000000000000000000000000000
AAAAAG1331000000000000000000000000000000
AAAUUG1591000000000000000000000000000000
UUUUG30,3572000000000000000000000000000000
CCCUCUG1371000000000000000000000000000000
CUCCUUG101,377,4261000000000000000000000000000000
AAUCUCG119,379,4501000000000000000000000000000000
CAUUUCACUG1661000000000000000000000000000000
AUAAAUCCAUAG189,4371000000000000000000000000000000
CCUCG369,443000000000000000000000000000000
AAUACUG3211000000000000000000000000000000
CAUAAUG196,2291000000000000000000000000000000
AAACACG150,427,442,4901000000000000000000000000000000
ACCAAG1831000000000000000000000000000000
UCUAACG1551000000000000000000000000000000
UAAAACCCAUACG2351000000000000000000000000000000
CACAAUCG2001000000000000000000000000000000
CAUAG891000000000000000000000000000000
ACCCGAAAG296,464,4761000000000000000000000000000000
AACUAUG114,390,4221000000000000000000000000000000
UAGCG1491000000000000000000000000000000
CAAAUCG1321000000000000000000000000000000
ACUAAUCG2281000000000000000000000000000000
AACCAUCUAG312,522,791000000000000000000000000000000
UUCCUG691000000000000000000000000000000
UAUCAG851000000000000000000000000000000
UUUUAUG671000000000000000000000000000000
AUUAG1791000000000000000000000000000000
UUCCG721000000000000000000000000000000
AAAUG1751000000000000000000000000000000
ACCUUG761000000000000000000000000000000
ACCUAUUCUCAAACUUUAAAUAUG4701000000000000000000000000000000
UUACUUAAUUG1721000000000000000000000000000000
ACAUUUG931000000000000000000000000000000
CUUUUAG3351000000000000000000000000000000
CCAUUUUUG193,2731000000000000000000000000000000
AACUG572000000000000000000000000000000
AACCG1631000000000000000000000000000000
UUAAG202000000000000000000000000000000
AAUACACG203,2971000000000000000000000000000000
CUCAUCAG1861000000000000000000000000000000
ACACCACAAAAG2471000000000000000000000000000000
UUCAUCUAG2191000000000000000000000000000000
AAUCCG292000000000000000000000000000000
UAACAACUCACCG2451000000000000000000000000000000
AACUAG1381000000000000000000000000000000
CCCUG3543000000000000000000000000000000
CUCAAG901000000000000000000000000000000
AUAUG462000000000000000000000000000000
CCUAG1061000000000000000000000000000000
CCUCUAG412000000000000000000000000000000
AUCUUG941000000000000000000000000000000
UAGCAAAUAUUCAAAUG339,412,497,5721000000000000000000000000000000
UUCCACG861000000000000000000000000000000
UCAACAG841000000000000000000000000000000
AUCCUAAG2231000000000000000000000000000000
CUCCG40,419,5672000000000000000000000000000000
UUUCAAAG2261000000000000000000000000000000
AUUUUAUG1841000000000000000000000000000000
CCACCAUCG204,2781000000000000000000000000000000
AUUCUUCACG1691000000000000000000000000000000
CUUAUCACCCCG1981000000000000000000000000000000
UUUAUCCG1761000000000000000000000000000000
UCUUAUG911000000000000000000000000000000
CACCUUUG162,2681000000000000000000000000000000
AAAAUCCACAG1921000000000000000000000000000000
UUUUCAUG1911000000000000000000000000000000
AUAACCG1641000000000000000000000000000000
UCUCCAAG1731000000000000000000000000000000
AAUAAUG1021000000000000000000000000000000
AAUAAUGUAG561000000000000000000000000000000
AUAAG582000000000000000000000000000000
AUCCG392000000000000000000000000000000
UAACUUCG187,2771000000000000000000000000000000
CUCUG37,3752000000000000000000000000000000
ACUACUUG1771000000000000000000000000000000
UCUCUUG751000000000000000000000000000000
CUACAAUUAACG2151000000000000000000000000000000
AUCAACUUAG1711000000000000000000000000000000
ACAAG1441000000000000000000000000000000
AAUCUG921000000000000000000000000000000
UCUAAUUAAAACAUAG322,404,502,5881000000000000000000000000000000
CAAUG242000000000000000000000000000000
AUUUCUG961000000000000000000000000000000
CCCAG1291000000000000000000000000000000
UCAAAG781000000000000000000000000000000
AAGAAAUUCAACCAAG6901000000000000000000000000000000
AAAUUCAACCAAG211,436,533,571,5831000000000000000000000000000000
UAAACG1131000000000000000000000000000000
UAACUAUG180,3111000000000000000000000000000000
ACUCUCUUAAG1571000000000000000000000000000000
CCAAAUG1411000000000000000000000000000000
CCUCGUCAUCUAAUUAG324,394,493,5751000000000000000000000000000000
AUUCCCACUG1471000000000000000000000000000000
UCCCUAUCUACUAUCUAG4231000000000000000000000000000000
AAACCACAG2411000000000000000000000000000000
AAUCAG1341000000000000000000000000000000
ACCCUG1271000000000000000000000000000000
ACUCUAG1361000000000000000000000000000000
ACAUUG232,83000000000000000000000000000000
AAAUACCACUACCUUUAUAG340,547,6221000000000000000000000000000000
UUUCUUUACUUAUUCAAUG3161000000000000000000000000000000
AAUUCAUUUUCCACG263,424,473,528,626,6321000000000000000000000000000000
UUCUAG1451000000000000000000000000000000
CAUUCAAG2341000000000000000000000000000000
UCCCAUUCG1741000000000000000000000000000000
CACAUCUG681000000000000000000000000000000
UUAAACG1101000000000000000000000000000000
CUCAUG1121000000000000000000000000000000
AAAUCUCCAG2391000000000000000000000000000000
AACAAAAG214,315,4351000000000000000000000000000000
UAAAAG1181000000000000000000000000000000
CCCCCUUG221,291,4631000000000000000000000000000000
AUUUUCAG201,2861000000000000000000000000000000
AAUACAAACCAUG227,4671000000000000000000000000000000
CCUAUCG951000000000000000000000000000000
AUCCUUUAG2071000000000000000000000000000000
UCCCUCG104,3651000000000000000000000000000000
CUAGAGG185,3591000000000000000000000000000000
UUACCACAG252,2791000000000000000000000000000000
AUAACUG1401000000000000000000000000000000
UUCAUAG1171000000000000000000000000000000
CUUUUUG1521000000000000000000000000000000
AUUCUUCG1781000000000000000000000000000000
AAUUCG1941000000000000000000000000000000
AUUGUUCACCCACUAAUAG343,5431000000000000000000000000000000
UUUUACCCUACUG2171000000000000000000000000000000
UUACCG1231000000000000000000000000000000
CAAUAG881000000000000000000000000000000
AACUUAG1651000000000000000000000000000000
UUCAUUCG197,2851000000000000000000000000000000
AUAAUUG2991000000000000000000000000000000
UUUUUG701000000000000000000000000000000
CUACCAUCCG1461000000000000000000000000000000
AUUAUG1151000000000000000000000000000000
CCUCUAAG1951000000000000000000000000000000
AAUCCAUG224,3021000000000000000000000000000000
AUUUCUUUG2201000000000000000000000000000000
AUACG1311000000000000000000000000000000
AACCAUAG238,3081000000000000000000000000000000
CAACG1391000000000000000000000000000000
CACUUG981000000000000000000000000000000
UCAUUUUG2131000000000000000000000000000000
AUAAAUCAUUUG199,4591000000000000000000000000000000
UACAACG1511000000000000000000000000000000
UUACG1031000000000000000000000000000000
CCUUUG821000000000000000000000000000000
ACUAG2480100000000000000000000000000000
AUUACG530001000000000000000000000000000


MS/MS Ion Search

Matched Nucleotide List (overall)