Ariadne: Results view

search> search log> results view


Search parameter
Nucleotide mapping

Score histgram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)


Search parameter

mgf_file: 141203_c25S_5dU_50f_spice11_20160712.mgf
database: S_cerevisiae/rRNA
Enzyme_pattern_file: RNaseT1.txt

max_mods: 0
max_missed_cleavages: 2
fp: 5pP
tp: OH3p
Mass_tolerance: 5
MS2_tolerance: 20
mass_table: 5D_CU
base_number: 3
reject_length_for_mapping: 3

more


Nucleotide mapping

Score histgram


Identification summary
RNA desc score matched sum matched_positions matched_sequences
2_1 Sce_25S_rRNA 356.43 174 1713 2_5, 6_17, 25_30, 42_53, 60_64, 65_74, 77_80, 81_86, 87_91, 105_110, 111_120, 129_136, 149_155, 163_170, 177_183, 184_189, 190_196, 198_202, 221_227, 252_256, 259_264, 278_281, 284_287, 291_297, 305_320, 321_330, 342_345, 348_353, 354_358, 365_368, 372_376, 377_383, 384_388, 395_400, 407_412, 416_419, 427_432, 433_437, 446_450, 453_459, 460_466, 477_483, 484_493, 496_499, 500_505, 506_510, 519_530, 532_535, 539_542, 543_547, 549_552, 569_575, 576_579, 601_604, 618_624, 640_644, 653_658, 669_674, 681_684, 689_701, 709_712, 715_718, 729_733, 734_737, 743_750, 755_760, 775_779, 782_785, 788_792, 806_809, 839_842, 871_875, 881_887, 888_891, 913_916, 917_924, 925_934, 942_947, 965_968, 979_984, 995_999, 1002_1005, 1006_1010, 1014_1018, 1025_1029, 1030_1035, 1060_1063, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1128_1131, 1135_1139, 1153_1157, 1158_1161, 1167_1171, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1223_1229, 1238_1242, 1251_1256, 1269_1281, 1286_1289, 1290_1295, 1296_1300, 1314_1319, 1341_1344, 1350_1354, 1358_1362, 1384_1387, 1396_1400, 1405_1408, 1418_1421, 1422_1429, 1423_1429, 1467_1473, 1489_1492, 1494_1500, 1501_1507, 1529_1536, 1548_1552, 1553_1560, 1566_1573, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1669_1673, 1701_1712, 1720_1727, 1737_1743, 1755_1758, 1759_1766, 1771_1775, 1781_1784, 1797_1807, 1818_1825, 1826_1829, 1839_1845, 1853_1860, 1864_1868, 1869_1875, 1879_1882, 1893_1897, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1964_1968, 1970_1973, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2053_2057, 2063_2069, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2151_2155, 2162_2165, 2166_2169, 2181_2185, 2202_2206, 2207_2210, 2211_2216, 2222_2234, 2284_2288, 2312_2315, 2326_2335, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2386_2391, 2397_2400, 2404_2409, 2415_2418, 2426_2429, 2430_2435, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2580_2584, 2593_2598, 2599_2602, 2611_2614, 2625_2632, 2640_2645, 2652_2658, 2664_2669, 2673_2677, 2678_2687, 2691_2698, 2701_2706, 2707_2714, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2851_2856, 2857_2863, 2902_2907, 2909_2912, 2919_2922, 2940_2943, 2969_2972, 2978_2990, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3066_3069, 3070_3074, 3076_3080, 3089_3098, 3103_3108, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3178_3182, 3183_3188, 3192_3197, 3209_3216, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3272_3276, 3277_3284, 3292_3303, 3310_3315, 3319_3325, 3334_3337, 3349_3353, 3357_3361, 3362_3366, 3372_3377, 3378_3383, 3387_3390, 3391_3395 UUUG, ACCUCAAAUCAG, UACCCG, CAUAUCAAUAAG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, CAAAAG, CUCAAAUUUG, UACCUUCG, UAAUUUG, CAACUUUG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, AAUCCCG, UAAAG, CCUUCG, UUUG, AAUG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, AUAG, AACAAG, UACAG, AAAG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, AAAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, AUAAAUCCAUAG, AAUG, CUUG, CCUCG, UAAG, AAUACUG, CCAG, UAAG, CAUAAUG, UCUUG, ACCAAG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, CCUCG, CAAG, CACAAUCG, AUCCUG, AUUUG, UAAG, CAUAG, AAAG, CCAG, UUCUG, CAAAUCG, AUCG, AAAG, ACUAAUCG, AACCAUCUAG, UUCCUG, AUAG, UAUCAG, UAAAG, AAUG, AUUAG, UUCCG, AAAUG, ACCUUG, UAAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, UAAG, AACUG, AACCG, AACG, UUAAG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, ACAGCCG, CCAUG, AAUCCG, UAACAACUCACCG, AAUG, AACUAG, CCCUG, CUCAAG, UCAG, AUAUG, CCCUG, UCAG, CCUAG, UAAG, AACG, GCCUCUAG, CCUCUAG, AACUUUG, AAAG, UUCCACG, UCAACAG, AUCCUAAG, CUCCG, UUUCAAAG, AUUUUAUG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, CCCUG, CUUAUCACCCCG, UUUAUCCG, UCUUAUG, CCAG, CACCUUUG, CUCCG, CUUG, AAAAUCCACAG, UUUUCAUG, CCAG, AUAACCG, UCUCCAAG, AACAG, CCUCUAG, AUAG, AUAAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, CCUUG, UCAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, CCUUG, UCUCUUG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, CAUUG, UCAG, AAAG, CAAUG, CUCUG, AAUG, UCAAAG, AAAUUCAACCAAG, CCUCG, AAUG, AUUCCCACUG, AAACCACAG, CCAAG, AACG, CUUG, AAUCAG, AAAG, ACCCUG, CUUG, UUUG, ACAUUG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, AUCCG, ACAUUG, UCAG, UUUG, CACAUCUG, AUAACG, UCCUAAG, CUCAUG, AACAG, AAAUCUCCAG, AACAAAAG, UAAAAG, CCCCCUUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, ACAUUG, CUUUUUG, AAUUCG, UAAG, AUUG, AACG, ACAG, UUUUACCCUACUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, UCUG, AUCAG, CAUUG, CUACCAUCCG, AUUAUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUACG, AAUAAG, UCCUUG, AACCAUAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, ACUUAG, UACAACG, UAAG, CCUUG, UUACG, AUCUG, AUUAAG, CCUUUG, UCUG, AUUUG
1_3 Sce_18S_rRNA 19.79 5 20 11_16, 17_20, 31_34, 43_48, 49_53 AUCCUG, CCAG, CUUG, AUUAAG, CCAUG
1_223 Sce_18S_rRNA 18.33 6 34 939_942, 943_948, 949_953, 973_976, 977_980, 988_991, 998_1002 AAAG, CAUUUG, CCAAG, AACG, AAAG, AUCG, AUCAG
1_327 Sce_18S_rRNA 16.92 4 14 1300_1304, 1305_1308, 1319_1324, 1325_1328 AUUUG, UCUG, AUAACG, AACG
1_111 Sce_18S_rRNA 14.62 6 39 499_503, 504_509, 511_514, 554_557, 558_561, 565_568 UCUUG, UAAUUG, AAUG, CAAG, UCUG, CCAG
1_69 Sce_18S_rRNA 11.70 3 15 358_362, 366_371, 378_383 UAACG, AAUAAG, AUUCCG
1_394 Sce_18S_rRNA 11.20 5 31 1543_1546, 1549_1553, 1585_1588, 1591_1594, 1602_1605 AUAG, CAUUG, UAAG, CAAG, CUUG
1_363 Sce_18S_rRNA 9.96 2 8 1449_1453, 1456_1462 UUCUG, CCGCACG
1_302 Sce_18S_rRNA 9.67 2 5 1230_1233, 1234_1237, 1238_1241 AUUG, ACAG, AUUG
1_167 Sce_18S_rRNA 9.58 2 6 715_720, 724_729 UCCUUG, CUCUUG
1_417 Sce_18S_rRNA 9.29 2 3 1655_1658, 1659_1662 AUUG, AAUG
1_211 Sce_18S_rRNA 8.92 2 6 880_885, 896_899 CAUCAG, UCAG
1_426 Sce_18S_rRNA 6.34 1 1 1681_1685 AUCUG
1_145 Sce_18S_rRNA 5.93 1 1 635_641 AACUUUG
1_247 Sce_18S_rRNA 5.93 1 1 1043_1046 AUCG
1_262 Sce_18S_rRNA 5.93 1 1 1103_1107 UUCUG
1_339 Sce_18S_rRNA 5.93 1 1 1359_1364 CAUUUG
1_383 Sce_18S_rRNA 5.93 1 1 1508_1512 UCUUG
1_272 Sce_18S_rRNA 5.65 1 1 1123_1126 CAAG
1_353 Sce_18S_rRNA 5.51 2 11 1413_1416, 1430_1433 UUUG, UCUG
1_23 Sce_18S_rRNA 5.24 1 1 124_127 AUAG
1_48 Sce_18S_rRNA 5.24 1 1 275_279 CCUUG
1_61 Sce_18S_rRNA 5.24 1 1 331_334 AUAG
1_192 Sce_18S_rRNA 5.09 1 1 820_823 UUUG
1_374 Sce_18S_rRNA 4.73 1 1 1481_1484 CCAG
1_18 Sce_18S_rRNA 4.55 1 1 92_95 AAUG

Oligonucleotide-RNA matrix
  RNA 2_1 1_3 1_223 1_327 1_111 1_69 1_394 1_363 1_302 1_167 1_417 1_211 1_426 1_145 1_247 1_262 1_339 1_383 1_272 1_353 1_23 1_48 1_61 1_192 1_374 1_18
  rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 14 14 14 14 19 20 21 21 21 24 25 26
  score 356.43 19.79 18.33 16.92 14.62 11.70 11.20 9.96 9.67 9.58 9.29 8.92 6.34 5.93 5.93 5.93 5.93 5.93 5.65 5.51 5.24 5.24 5.24 5.09 4.73 4.55
  length 3394 43 64 29 70 26 63 14 12 15 8 20 5 7 4 5 6 5 4 21 4 5 4 4 4 4
oligonucleotide q#                                                    
CCAG 16 7 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
CUUG 1,517 10 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUG 66 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAUG 100 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAAG 148 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACG 12 8 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCG 122 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
CAUUUG 73 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
AUCAG 7 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAAG 105 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAG 4 11 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUG 52 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
AUAACG 113 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUG 83 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAG 158 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
AAUG 9 9 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
UCUUG 71 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
UAAUUG 97 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUAAG 60 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCG 87 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACG 34 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAG 54 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0
UAAG 2 8 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUG 314 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUG 108 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
AUUG 50 3 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAG 65 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUUG 18,303 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAG 15 6 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUCAG 99 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCUG 181 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUUG 62 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
UUUG 17 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
CCUUG 5,246 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
AACUUAG 165 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCUUG 75 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCAACCG 257,396,457 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCUUG 101,377,426 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUUUAG 207 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUCG 125,449 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAACCCAUACG 235 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCG 194 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACG 139 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUG 37,375 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACACG 203,297 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUACCACUACCUUUAUAG 340,547,622 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCCUG 127 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAACAG 84 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCACAG 241 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCG 44,369 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUCAACCAAG 211,436,533,571,583 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACAACUCACCG 245 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAG 107 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUACCCUACUG 217 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUUG 93 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCCAAG 173 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCG 40,419,567 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCAUUUUCCACG 263,424,473,528,626,632 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCG 39 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCG 72 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAAUCG 200 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUUAUG 184 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAG 89 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAG 179 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUG 24 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAG 47 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCG 123 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUAUG 33 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUCUAG 79,312,522 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUAG 238,308 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUCAG 186 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCAAAG 226 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUG 69 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUAG 116 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCUUCG 202 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUAAUCG 228 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
GCCUCUAG 201,286 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUAAG 26,267 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUCUUUG 220 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAAUG 196,229 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCACAG 252,279 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCUUCACG 169 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUUG 43 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAAG 124 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAUUCCAUCUAAAG 334,400 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAAUUUG 182 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCUCG 104,365 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUCUG 137 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUAUCCG 176 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCAACUUAG 171 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAUUG 299 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAGCCG 110 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCUCG 119,379,450 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCUUUACUUAUUCAAUG 316 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUG 159 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUCAAG 234 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAAAG 214,315,435 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAG 41 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUCUCCAG 239 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCAUG 224,302 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUACUUG 177 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCCAUAG 189,437 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCAAG 183 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACUUUG 121,265 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUAAG 223 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACUG 140 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAUCG 95 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAACG 151 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAG 90 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUG 8,232 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAAAG 78 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAUUUG 59 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAUCCACAG 192 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAG 154 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAUG 46 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCCG 160 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUAG 145 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUG 30,357 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUACG 131 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACAAUUAACG 215 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCCACUG 147 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAG 22 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUUUUG 152 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACUG 35,321 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAAG 118 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCAUUCG 174 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUUG 70 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUUAUG 91 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACCG 164 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCACG 86 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACUUAAUUG 172 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUAAG 267 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAAG 195 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCG 29 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACUUCG 187,277 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUCUAG 219 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACACCACAAAAG 247 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACG 103 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUG 354 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUG 112 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCAUUUG 199,459 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUCACUG 166 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAUCAAUAAG 218,505 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAUCG 132 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAAG 144 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCG 163 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCCG 126 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUAUCACCCCG 198 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCACCAUCG 204,278 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUAG 88 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCCCUUG 221,291,463 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAUG 115 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUAAAUAUUG 190 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAUCUG 68 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUCAUG 191 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACCUUUG 162,268 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAAG 133 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAG 106 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUUG 76 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUG 57 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUAAG 20 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUUG 82 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACUUG 98 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAUCAG 85 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUG 175 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAG 25,259 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACCAUCCG 146 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCAG 134 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUUAG 53 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUAG 138 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAG 58 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUUCG 197,285 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUCAAAUCAG 236 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAUUUUG 213 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCGCACG 155 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUUG 303 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0


MS/MS ion search

Matched nucleotide list(overall)
E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science