Ariadne: Results view


Search parameter
Nucleotide mapping

Score histgram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)


Search parameter

search_ID: 20160726090833.dat
mgf_file: 141203_c25S_5dU_50f_spice11.mgf
database: S_cerevisiae_rRNA.fasta

Enzyme_pattern_file: RNaseT1.txt
max_mods: 0
max_missed_cleavages: 2
fp: 5pP
tp: OH3p
Mass_tolerance: 5
MS2_tolerance: 20
mass_table: 5D_CU
base_number: 3
reject_length_for_mapping: 3
polarity: negative

more


Nucleotide mapping

Score histgram


Identification summary
RNA desc score matched sum matched_positions matched_sequences
2_1 Sce_25S_rRNA 348.40 173 1713 2_5, 6_17, 25_30, 42_53, 60_64, 65_74, 77_80, 81_86, 87_91, 105_110, 111_120, 129_136, 149_155, 163_170, 177_183, 184_189, 190_196, 198_202, 221_227, 252_256, 259_264, 278_281, 284_287, 291_297, 305_320, 321_330, 342_345, 348_353, 354_358, 365_368, 372_376, 377_383, 384_388, 395_400, 407_412, 416_419, 427_432, 433_437, 446_450, 453_459, 460_466, 477_483, 484_493, 496_499, 500_505, 506_510, 519_530, 532_535, 539_542, 543_547, 549_552, 569_575, 576_579, 601_604, 618_624, 640_644, 653_658, 669_674, 681_684, 689_701, 709_712, 715_718, 729_733, 734_737, 743_750, 755_760, 775_779, 782_785, 788_792, 806_809, 839_842, 871_875, 881_887, 888_891, 913_916, 917_924, 925_934, 942_947, 965_968, 979_984, 995_999, 1002_1005, 1006_1010, 1014_1018, 1025_1029, 1030_1035, 1060_1063, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1128_1131, 1135_1139, 1153_1157, 1158_1161, 1167_1171, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1223_1229, 1238_1242, 1251_1256, 1269_1281, 1286_1289, 1290_1295, 1296_1300, 1314_1319, 1341_1344, 1350_1354, 1358_1362, 1384_1387, 1396_1400, 1405_1408, 1418_1421, 1422_1429, 1423_1429, 1467_1473, 1489_1492, 1494_1500, 1501_1507, 1529_1536, 1548_1552, 1553_1560, 1566_1573, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1669_1673, 1701_1712, 1720_1727, 1737_1743, 1755_1758, 1759_1766, 1771_1775, 1781_1784, 1797_1807, 1818_1825, 1826_1829, 1839_1845, 1853_1860, 1864_1868, 1869_1875, 1879_1882, 1893_1897, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1964_1968, 1970_1973, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2053_2057, 2063_2069, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2151_2155, 2162_2165, 2166_2169, 2181_2185, 2202_2206, 2207_2210, 2211_2216, 2222_2234, 2284_2288, 2312_2315, 2326_2335, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2386_2391, 2397_2400, 2404_2409, 2415_2418, 2426_2429, 2430_2435, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2580_2584, 2593_2598, 2599_2602, 2611_2614, 2640_2645, 2652_2658, 2664_2669, 2673_2677, 2678_2687, 2691_2698, 2701_2706, 2707_2714, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2851_2856, 2857_2863, 2902_2907, 2909_2912, 2919_2922, 2940_2943, 2969_2972, 2978_2990, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3066_3069, 3070_3074, 3076_3080, 3089_3098, 3103_3108, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3178_3182, 3183_3188, 3192_3197, 3209_3216, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3272_3276, 3277_3284, 3292_3303, 3310_3315, 3319_3325, 3334_3337, 3349_3353, 3357_3361, 3362_3366, 3372_3377, 3378_3383, 3387_3390, 3391_3395 UUUG, ACCUCAAAUCAG, UACCCG, CAUAUCAAUAAG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, CAAAAG, CUCAAAUUUG, UACCUUCG, UAAUUUG, CAACUUUG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, AAUCCCG, UAAAG, CCUUCG, UUUG, AAUG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, AUAG, AACAAG, UACAG, AAAG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, AAAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, AUAAAUCCAUAG, AAUG, CUUG, CCUCG, UAAG, AAUACUG, CCAG, UAAG, CAUAAUG, UCUUG, ACCAAG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, CCUCG, CAAG, CACAAUCG, AUCCUG, AUUUG, UAAG, CAUAG, AAAG, CCAG, UUCUG, CAAAUCG, AUCG, AAAG, ACUAAUCG, AACCAUCUAG, UUCCUG, AUAG, UAUCAG, UAAAG, AAUG, AUUAG, UUCCG, AAAUG, ACCUUG, UAAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, UAAG, AACUG, AACCG, AACG, UUAAG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, ACAGCCG, CCAUG, AAUCCG, UAACAACUCACCG, AAUG, AACUAG, CCCUG, CUCAAG, UCAG, AUAUG, CCCUG, UCAG, CCUAG, UAAG, AACG, GCCUCUAG, CCUCUAG, AACUUUG, AAAG, UUCCACG, UCAACAG, AUCCUAAG, CUCCG, UUUCAAAG, AUUUUAUG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, CCCUG, CUUAUCACCCCG, UUUAUCCG, UCUUAUG, CCAG, CACCUUUG, CUCCG, CUUG, AAAAUCCACAG, UUUUCAUG, CCAG, AUAACCG, UCUCCAAG, AACAG, CCUCUAG, AUAG, AUAAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, CCUUG, UCAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, CCUUG, UCUCUUG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, CAUUG, UCAG, AAAG, CAAUG, CUCUG, AAUG, UCAAAG, AAAUUCAACCAAG, CCUCG, AAUG, AUUCCCACUG, AAACCACAG, CCAAG, AACG, CUUG, AAUCAG, AAAG, ACCCUG, CUUG, UUUG, ACAUUG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, AUCCG, ACAUUG, UCAG, UUUG, AUAACG, UCCUAAG, CUCAUG, AACAG, AAAUCUCCAG, AACAAAAG, UAAAAG, CCCCCUUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, ACAUUG, CUUUUUG, AAUUCG, UAAG, AUUG, AACG, ACAG, UUUUACCCUACUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, UCUG, AUCAG, CAUUG, CUACCAUCCG, AUUAUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUACG, AAUAAG, UCCUUG, AACCAUAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, ACUUAG, UACAACG, UAAG, CCUUG, UUACG, AUCUG, AUUAAG, CCUUUG, UCUG, AUUUG
1_3 Sce_18S_rRNA 19.79 5 20 11_16, 17_20, 31_34, 43_48, 49_53 AUCCUG, CCAG, CUUG, AUUAAG, CCAUG
1_223 Sce_18S_rRNA 18.33 6 34 939_942, 943_948, 949_953, 973_976, 977_980, 988_991, 998_1002 AAAG, CAUUUG, CCAAG, AACG, AAAG, AUCG, AUCAG
1_327 Sce_18S_rRNA 16.92 4 14 1300_1304, 1305_1308, 1319_1324, 1325_1328 AUUUG, UCUG, AUAACG, AACG
1_111 Sce_18S_rRNA 14.62 6 39 499_503, 504_509, 511_514, 554_557, 558_561, 565_568 UCUUG, UAAUUG, AAUG, CAAG, UCUG, CCAG
1_69 Sce_18S_rRNA 11.70 3 15 358_362, 366_371, 378_383 UAACG, AAUAAG, AUUCCG
1_394 Sce_18S_rRNA 11.20 5 31 1543_1546, 1549_1553, 1585_1588, 1591_1594, 1602_1605 AUAG, CAUUG, UAAG, CAAG, CUUG
1_363 Sce_18S_rRNA 9.96 2 8 1449_1453, 1456_1462 UUCUG, CCGCACG
1_302 Sce_18S_rRNA 9.67 2 5 1230_1233, 1234_1237, 1238_1241 AUUG, ACAG, AUUG
1_167 Sce_18S_rRNA 9.58 2 6 715_720, 724_729 UCCUUG, CUCUUG
1_417 Sce_18S_rRNA 9.29 2 3 1655_1658, 1659_1662 AUUG, AAUG
1_211 Sce_18S_rRNA 8.92 2 6 880_885, 896_899 CAUCAG, UCAG
1_426 Sce_18S_rRNA 6.34 1 1 1681_1685 AUCUG
1_145 Sce_18S_rRNA 5.93 1 1 635_641 AACUUUG
1_247 Sce_18S_rRNA 5.93 1 1 1043_1046 AUCG
1_262 Sce_18S_rRNA 5.93 1 1 1103_1107 UUCUG
1_339 Sce_18S_rRNA 5.93 1 1 1359_1364 CAUUUG
1_383 Sce_18S_rRNA 5.93 1 1 1508_1512 UCUUG
1_272 Sce_18S_rRNA 5.65 1 1 1123_1126 CAAG
1_353 Sce_18S_rRNA 5.51 2 11 1413_1416, 1430_1433 UUUG, UCUG
1_23 Sce_18S_rRNA 5.24 1 1 124_127 AUAG
1_48 Sce_18S_rRNA 5.24 1 1 275_279 CCUUG
1_61 Sce_18S_rRNA 5.24 1 1 331_334 AUAG
1_192 Sce_18S_rRNA 5.09 1 1 820_823 UUUG
1_374 Sce_18S_rRNA 4.73 1 1 1481_1484 CCAG
1_18 Sce_18S_rRNA 4.55 1 1 92_95 AAUG

Oligonucleotide-RNA matrix
  RNA 2_1 1_3 1_223 1_327 1_111 1_69 1_394 1_363 1_302 1_167 1_417 1_211 1_426 1_145 1_247 1_262 1_339 1_383 1_272 1_353 1_23 1_48 1_61 1_192 1_374 1_18
  rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 14 14 14 14 19 20 21 21 21 24 25 26
  score 348.40 19.79 18.33 16.92 14.62 11.70 11.20 9.96 9.67 9.58 9.29 8.92 6.34 5.93 5.93 5.93 5.93 5.93 5.65 5.51 5.24 5.24 5.24 5.09 4.73 4.55
  length 3394 43 64 29 70 26 63 14 12 15 8 20 5 7 4 5 6 5 4 21 4 5 4 4 4 4
oligonucleotide q#                                                    
CCAG 16 7 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
CUUG 1,517 10 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAUG 100 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUG 66 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAAG 148 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACG 12 8 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUG 73 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
AUCG 122 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
AUCAG 7 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAG 4 11 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAAG 105 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUG 52 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
AUAACG 113 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUG 83 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAG 158 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
AAUG 9 9 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
UCUUG 71 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
UAAUUG 97 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCG 87 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUAAG 60 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACG 34 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAG 54 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0
CAUUG 314 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAG 2 8 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUG 108 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
AUUG 50 3 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAG 65 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUUG 18,303 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUCAG 99 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAG 15 6 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCUG 181 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUUG 62 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
UUUG 17 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
CCUUG 5,246 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
ACAUUG 8,232 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCUUG 75 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUCAG 68,186 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCACCAUCG 204,278 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACAACUCACCG 245 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUAAG 267 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUG 37,375 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAUUUG 59 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCACAG 241 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUACG 131 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCAUUUUCCACG 263,424,473,528,626,632 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAG 22 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAUG 115 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAAG 133 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCACAG 252,279 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUCAUG 191 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCAUUCG 174 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCG 44,369 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUCUAG 79,312,522 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCG 40,419,567 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCUCG 119,379,450 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUG 159 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUUAUG 91 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUAG 138 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUCG 125,449 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAUCCACAG 192 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAG 58 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUUAUG 184 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUCAAG 234 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUUUAG 207 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUAG 88 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACCUUUG 162,268 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUAAG 26,267 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUG 30,357 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAG 179 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAG 89 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUUUUG 152 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUACCCUACUG 217 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUAAAUAUUG 190 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUUG 82 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCACG 86 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAUCG 132 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAAUCG 200 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUAAG 20 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCAUUUG 199,459 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUCUG 137 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAAUG 196,229 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUG 69 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUG 175 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAG 47 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAUCG 95 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAUCAG 85 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAUUG 299 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCCG 126 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCAAG 183 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCG 29 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCG 194 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUCUUUG 220 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAACAG 84 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAAAG 78 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAG 154 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCAAAG 226 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAUUUUG 213 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAUCAAUAAG 218,505 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCAACUUAG 171 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACAAUUAACG 215 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCUUCG 202 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCAUG 224,302 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUG 354 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUG 24 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCCAAG 173 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAG 90 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCAG 134 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACUUG 98 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUAG 238,308 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCG 123 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUUG 93 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCUCG 104,365 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUCUAG 219 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUCUCCAG 239 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCCCUUG 221,291,463 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUAUCACCCCG 198 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACUUCG 187,277 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUCACUG 166 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUUCG 197,285 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUUG 70 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUAG 165 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAG 25,259 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACCG 164 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACACCACAAAAG 247 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACACG 203,297 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAGCCG 110 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCCACUG 147 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACG 139 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAACG 151 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCCAUAG 189,437 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUACUUG 177 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCCG 160 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUG 57 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUACCACUACCUUUAUAG 340,547,622 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACG 103 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUAG 145 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCAACCG 257,396,457 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCUUUACUUAUUCAAUG 316 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAAG 195 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUCAACCAAG 211,436,533,571,583 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCG 72 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUUAG 53 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUUG 76 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUAUCCG 176 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAAUUUG 182 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAACCCAUACG 235 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAG 41 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAAG 144 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUAUG 33 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAG 106 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCUUG 101,377,426 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCG 163 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUG 112 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACUUAAUUG 172 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCUUCACG 169 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUUG 43 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACCAUCCG 146 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAAAG 214,315,435 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACUG 35,321 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
GCCUCUAG 201,286 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACUUUG 121,265 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUCAAAUCAG 236 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAAG 124 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUAAG 223 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCG 39 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACUG 140 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUAG 116 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCCUG 127 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUAAUCG 228 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAG 107 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAUUCCAUCUAAAG 334,400 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAAG 118 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAUG 46 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCGCACG 155 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUUG 303 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0


MS/MS ion search

Matched nucleotide list(overall)
E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science