Ariadne: Results view


Search parameter
Nucleotide mapping

Score histgram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)


Search parameter

search_ID: 20160726090833.dat
mgf_file: 141203_c25S_5dU_50f_spice11.mgf
database: S_cerevisiae_rRNA.fasta

Enzyme_pattern_file: RNaseT1.txt
max_mods: 0
max_missed_cleavages: 2
fp: 5pP
tp: OH3p
Mass_tolerance: 5
MS2_tolerance: 20
mass_table: 5D_CU
base_number: 3
reject_length_for_mapping: 3
polarity: negative

more


Nucleotide mapping

Score histgram


Identification summary
RNA desc score matched sum matched_positions matched_sequences
2_1 Sce_25S_rRNA 348.40 173 1713 2_5, 6_17, 25_30, 42_53, 60_64, 65_74, 77_80, 81_86, 87_91, 105_110, 111_120, 129_136, 149_155, 163_170, 177_183, 184_189, 190_196, 198_202, 221_227, 252_256, 259_264, 278_281, 284_287, 291_297, 305_320, 321_330, 342_345, 348_353, 354_358, 365_368, 372_376, 377_383, 384_388, 395_400, 407_412, 416_419, 427_432, 433_437, 446_450, 453_459, 460_466, 477_483, 484_493, 496_499, 500_505, 506_510, 519_530, 532_535, 539_542, 543_547, 549_552, 569_575, 576_579, 601_604, 618_624, 640_644, 653_658, 669_674, 681_684, 689_701, 709_712, 715_718, 729_733, 734_737, 743_750, 755_760, 775_779, 782_785, 788_792, 806_809, 839_842, 871_875, 881_887, 888_891, 913_916, 917_924, 925_934, 942_947, 965_968, 979_984, 995_999, 1002_1005, 1006_1010, 1014_1018, 1025_1029, 1030_1035, 1060_1063, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1128_1131, 1135_1139, 1153_1157, 1158_1161, 1167_1171, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1223_1229, 1238_1242, 1251_1256, 1269_1281, 1286_1289, 1290_1295, 1296_1300, 1314_1319, 1341_1344, 1350_1354, 1358_1362, 1384_1387, 1396_1400, 1405_1408, 1418_1421, 1422_1429, 1423_1429, 1467_1473, 1489_1492, 1494_1500, 1501_1507, 1529_1536, 1548_1552, 1553_1560, 1566_1573, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1669_1673, 1701_1712, 1720_1727, 1737_1743, 1755_1758, 1759_1766, 1771_1775, 1781_1784, 1797_1807, 1818_1825, 1826_1829, 1839_1845, 1853_1860, 1864_1868, 1869_1875, 1879_1882, 1893_1897, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1964_1968, 1970_1973, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2053_2057, 2063_2069, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2151_2155, 2162_2165, 2166_2169, 2181_2185, 2202_2206, 2207_2210, 2211_2216, 2222_2234, 2284_2288, 2312_2315, 2326_2335, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2386_2391, 2397_2400, 2404_2409, 2415_2418, 2426_2429, 2430_2435, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2580_2584, 2593_2598, 2599_2602, 2611_2614, 2640_2645, 2652_2658, 2664_2669, 2673_2677, 2678_2687, 2691_2698, 2701_2706, 2707_2714, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2851_2856, 2857_2863, 2902_2907, 2909_2912, 2919_2922, 2940_2943, 2969_2972, 2978_2990, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3066_3069, 3070_3074, 3076_3080, 3089_3098, 3103_3108, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3178_3182, 3183_3188, 3192_3197, 3209_3216, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3272_3276, 3277_3284, 3292_3303, 3310_3315, 3319_3325, 3334_3337, 3349_3353, 3357_3361, 3362_3366, 3372_3377, 3378_3383, 3387_3390, 3391_3395 UUUG, ACCUCAAAUCAG, UACCCG, CAUAUCAAUAAG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, CAAAAG, CUCAAAUUUG, UACCUUCG, UAAUUUG, CAACUUUG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, AAUCCCG, UAAAG, CCUUCG, UUUG, AAUG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, AUAG, AACAAG, UACAG, AAAG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, AAAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, AUAAAUCCAUAG, AAUG, CUUG, CCUCG, UAAG, AAUACUG, CCAG, UAAG, CAUAAUG, UCUUG, ACCAAG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, CCUCG, CAAG, CACAAUCG, AUCCUG, AUUUG, UAAG, CAUAG, AAAG, CCAG, UUCUG, CAAAUCG, AUCG, AAAG, ACUAAUCG, AACCAUCUAG, UUCCUG, AUAG, UAUCAG, UAAAG, AAUG, AUUAG, UUCCG, AAAUG, ACCUUG, UAAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, UAAG, AACUG, AACCG, AACG, UUAAG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, ACAGCCG, CCAUG, AAUCCG, UAACAACUCACCG, AAUG, AACUAG, CCCUG, CUCAAG, UCAG, AUAUG, CCCUG, UCAG, CCUAG, UAAG, AACG, GCCUCUAG, CCUCUAG, AACUUUG, AAAG, UUCCACG, UCAACAG, AUCCUAAG, CUCCG, UUUCAAAG, AUUUUAUG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, CCCUG, CUUAUCACCCCG, UUUAUCCG, UCUUAUG, CCAG, CACCUUUG, CUCCG, CUUG, AAAAUCCACAG, UUUUCAUG, CCAG, AUAACCG, UCUCCAAG, AACAG, CCUCUAG, AUAG, AUAAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, CCUUG, UCAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, CCUUG, UCUCUUG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, CAUUG, UCAG, AAAG, CAAUG, CUCUG, AAUG, UCAAAG, AAAUUCAACCAAG, CCUCG, AAUG, AUUCCCACUG, AAACCACAG, CCAAG, AACG, CUUG, AAUCAG, AAAG, ACCCUG, CUUG, UUUG, ACAUUG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, AUCCG, ACAUUG, UCAG, UUUG, AUAACG, UCCUAAG, CUCAUG, AACAG, AAAUCUCCAG, AACAAAAG, UAAAAG, CCCCCUUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, ACAUUG, CUUUUUG, AAUUCG, UAAG, AUUG, AACG, ACAG, UUUUACCCUACUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, UCUG, AUCAG, CAUUG, CUACCAUCCG, AUUAUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUACG, AAUAAG, UCCUUG, AACCAUAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, ACUUAG, UACAACG, UAAG, CCUUG, UUACG, AUCUG, AUUAAG, CCUUUG, UCUG, AUUUG
1_3 Sce_18S_rRNA 19.79 5 20 11_16, 17_20, 31_34, 43_48, 49_53 AUCCUG, CCAG, CUUG, AUUAAG, CCAUG
1_223 Sce_18S_rRNA 18.33 6 34 939_942, 943_948, 949_953, 973_976, 977_980, 988_991, 998_1002 AAAG, CAUUUG, CCAAG, AACG, AAAG, AUCG, AUCAG
1_327 Sce_18S_rRNA 16.92 4 14 1300_1304, 1305_1308, 1319_1324, 1325_1328 AUUUG, UCUG, AUAACG, AACG
1_111 Sce_18S_rRNA 14.62 6 39 499_503, 504_509, 511_514, 554_557, 558_561, 565_568 UCUUG, UAAUUG, AAUG, CAAG, UCUG, CCAG
1_69 Sce_18S_rRNA 11.70 3 15 358_362, 366_371, 378_383 UAACG, AAUAAG, AUUCCG
1_394 Sce_18S_rRNA 11.20 5 31 1543_1546, 1549_1553, 1585_1588, 1591_1594, 1602_1605 AUAG, CAUUG, UAAG, CAAG, CUUG
1_363 Sce_18S_rRNA 9.96 2 8 1449_1453, 1456_1462 UUCUG, CCGCACG
1_302 Sce_18S_rRNA 9.67 2 5 1230_1233, 1234_1237, 1238_1241 AUUG, ACAG, AUUG
1_167 Sce_18S_rRNA 9.58 2 6 715_720, 724_729 UCCUUG, CUCUUG
1_417 Sce_18S_rRNA 9.29 2 3 1655_1658, 1659_1662 AUUG, AAUG
1_211 Sce_18S_rRNA 8.92 2 6 880_885, 896_899 CAUCAG, UCAG
1_426 Sce_18S_rRNA 6.34 1 1 1681_1685 AUCUG
1_145 Sce_18S_rRNA 5.93 1 1 635_641 AACUUUG
1_247 Sce_18S_rRNA 5.93 1 1 1043_1046 AUCG
1_262 Sce_18S_rRNA 5.93 1 1 1103_1107 UUCUG
1_339 Sce_18S_rRNA 5.93 1 1 1359_1364 CAUUUG
1_383 Sce_18S_rRNA 5.93 1 1 1508_1512 UCUUG
1_272 Sce_18S_rRNA 5.65 1 1 1123_1126 CAAG
1_353 Sce_18S_rRNA 5.51 2 11 1413_1416, 1430_1433 UUUG, UCUG
1_23 Sce_18S_rRNA 5.24 1 1 124_127 AUAG
1_48 Sce_18S_rRNA 5.24 1 1 275_279 CCUUG
1_61 Sce_18S_rRNA 5.24 1 1 331_334 AUAG
1_192 Sce_18S_rRNA 5.09 1 1 820_823 UUUG
1_374 Sce_18S_rRNA 4.73 1 1 1481_1484 CCAG
1_18 Sce_18S_rRNA 4.55 1 1 92_95 AAUG

Oligonucleotide-RNA matrix
  RNA 2_1 1_3 1_223 1_327 1_111 1_69 1_394 1_363 1_302 1_167 1_417 1_211 1_426 1_145 1_247 1_262 1_339 1_383 1_272 1_353 1_23 1_48 1_61 1_192 1_374 1_18
  rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 14 14 14 14 19 20 21 21 21 24 25 26
  score 348.40 19.79 18.33 16.92 14.62 11.70 11.20 9.96 9.67 9.58 9.29 8.92 6.34 5.93 5.93 5.93 5.93 5.93 5.65 5.51 5.24 5.24 5.24 5.09 4.73 4.55
  length 3394 43 64 29 70 26 63 14 12 15 8 20 5 7 4 5 6 5 4 21 4 5 4 4 4 4
oligonucleotide q#                                                    
CCAG 16 7 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
CUUG 1,517 10 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAUG 100 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUG 66 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAAG 148 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACG 12 8 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCG 122 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
CAUUUG 73 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
CCAAG 105 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCAG 7 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAG 4 11 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUG 52 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
AUAACG 113 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUG 83 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAG 158 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
AAUG 9 9 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
UCUUG 71 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
UAAUUG 97 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACG 34 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUAAG 60 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCG 87 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAG 54 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0
UAAG 2 8 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUG 314 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUG 108 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
AUUG 50 3 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAG 65 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUUG 18,303 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUCAG 99 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAG 15 6 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCUG 181 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUUG 62 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
UUUG 17 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
CCUUG 5,246 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
UUCUAG 145 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAG 47 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCAACCG 257,396,457 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACUUCG 187,277 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUUAUG 91 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCACCAUCG 204,278 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUUG 43 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCG 44,369 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACUUG 98 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUCAUG 191 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCG 72 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUAG 138 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCG 163 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCAG 134 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUG 69 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCAAAG 226 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCACAG 252,279 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUUCG 197,285 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCCUG 127 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUUUAG 207 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACAACUCACCG 245 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUAUCACCCCG 198 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCCG 126 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAACCCAUACG 235 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACG 139 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUACCACUACCUUUAUAG 340,547,622 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUACG 131 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUUUUG 152 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAAG 195 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACUUUG 121,265 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUG 8,232 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAAG 118 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUUG 82 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUACUUG 177 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAUUG 299 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUAAUCG 228 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACAAUUAACG 215 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCAAG 183 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUUG 93 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUCACUG 166 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUCUAG 219 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCACAG 241 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCAUUUG 199,459 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUAAAUAUUG 190 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCUCG 104,365 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAAG 133 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACUUAAUUG 172 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAAG 144 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
GCCUCUAG 201,286 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAUCAAUAAG 218,505 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAG 89 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUCUG 137 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCG 29 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACUG 35,321 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAG 41 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCUUG 101,377,426 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAG 58 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUAAG 26,267 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACACCACAAAAG 247 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCUUUACUUAUUCAAUG 316 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCCAUAG 189,437 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUG 57 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAG 107 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUG 37,375 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUG 112 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACCUUUG 162,268 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUUAG 53 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUCUCCAG 239 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAAUCG 200 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACCG 164 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAG 25,259 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCAUUCG 174 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCG 39 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACCAUCCG 146 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCUUCG 202 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUCAAAUCAG 236 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAUUUUG 213 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUUAUG 184 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCUUG 75 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUCAAG 234 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAUCCACAG 192 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACUG 140 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCAUUUUCCACG 263,424,473,528,626,632 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUUG 76 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAUUUG 59 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCCAAG 173 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAUG 115 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAUUCCAUCUAAAG 334,400 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAUCG 132 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUCAACCAAG 211,436,533,571,583 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUCUAG 79,312,522 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUAG 88 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCCG 160 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAAUUUG 182 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUAUG 33 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAUCG 95 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUACCCUACUG 217 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAUCAG 85 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCCACUG 147 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAG 154 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCAUG 224,302 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCUCG 119,379,450 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUG 354 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAG 179 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAAAG 78 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACACG 203,297 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAUG 46 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCCCUUG 221,291,463 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAG 106 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAAAG 214,315,435 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUG 175 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUAAG 20 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUCUUUG 220 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUAAG 267 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUAG 238,308 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCAACUUAG 171 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCUUCACG 169 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUUG 70 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAACAG 84 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUAAG 223 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUCG 125,449 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACG 103 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAAG 124 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUAG 116 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCG 194 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAACG 151 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCG 123 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCG 40,419,567 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUAG 165 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAAUG 196,229 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUCAG 68,186 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUG 159 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUAUCCG 176 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCACG 86 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAG 90 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAG 22 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUG 24 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAGCCG 110 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUG 30,357 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCGCACG 155 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUUG 303 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0


MS/MS ion search

Matched nucleotide list(overall)
E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science