Ariadne: Results view

Search parameter
Nucleotide mapping

Score histogram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)

Browse search log

Search parameter


Nucleotide mapping

Score histogram

Identidication summary
2_1Sce_25S_rRNA348.4017317132_5, 6_17, 25_30, 42_53, 60_64, 65_74, 77_80, 81_86, 87_91, 105_110, 111_120, 129_136, 149_155, 163_170, 177_183, 184_189, 190_196, 198_202, 221_227, 252_256, 259_264, 278_281, 284_287, 291_297, 305_320, 321_330, 342_345, 348_353, 354_358, 365_368, 372_376, 377_383, 384_388, 395_400, 407_412, 416_419, 427_432, 433_437, 446_450, 453_459, 460_466, 477_483, 484_493, 496_499, 500_505, 506_510, 519_530, 532_535, 539_542, 543_547, 549_552, 569_575, 576_579, 601_604, 618_624, 640_644, 653_658, 669_674, 681_684, 689_701, 709_712, 715_718, 729_733, 734_737, 743_750, 755_760, 775_779, 782_785, 788_792, 806_809, 839_842, 871_875, 881_887, 888_891, 913_916, 917_924, 925_934, 942_947, 965_968, 979_984, 995_999, 1002_1005, 1006_1010, 1014_1018, 1025_1029, 1030_1035, 1060_1063, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1128_1131, 1135_1139, 1153_1157, 1158_1161, 1167_1171, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1223_1229, 1238_1242, 1251_1256, 1269_1281, 1286_1289, 1290_1295, 1296_1300, 1314_1319, 1341_1344, 1350_1354, 1358_1362, 1384_1387, 1396_1400, 1405_1408, 1418_1421, 1422_1429, 1423_1429, 1467_1473, 1489_1492, 1494_1500, 1501_1507, 1529_1536, 1548_1552, 1553_1560, 1566_1573, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1669_1673, 1701_1712, 1720_1727, 1737_1743, 1755_1758, 1759_1766, 1771_1775, 1781_1784, 1797_1807, 1818_1825, 1826_1829, 1839_1845, 1853_1860, 1864_1868, 1869_1875, 1879_1882, 1893_1897, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1964_1968, 1970_1973, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2053_2057, 2063_2069, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2151_2155, 2162_2165, 2166_2169, 2181_2185, 2202_2206, 2207_2210, 2211_2216, 2222_2234, 2284_2288, 2312_2315, 2326_2335, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2386_2391, 2397_2400, 2404_2409, 2415_2418, 2426_2429, 2430_2435, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2580_2584, 2593_2598, 2599_2602, 2611_2614, 2640_2645, 2652_2658, 2664_2669, 2673_2677, 2678_2687, 2691_2698, 2701_2706, 2707_2714, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2851_2856, 2857_2863, 2902_2907, 2909_2912, 2919_2922, 2940_2943, 2969_2972, 2978_2990, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3066_3069, 3070_3074, 3076_3080, 3089_3098, 3103_3108, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3178_3182, 3183_3188, 3192_3197, 3209_3216, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3272_3276, 3277_3284, 3292_3303, 3310_3315, 3319_3325, 3334_3337, 3349_3353, 3357_3361, 3362_3366, 3372_3377, 3378_3383, 3387_3390, 3391_3395UUUG, ACCUCAAAUCAG, UACCCG, CAUAUCAAUAAG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, CAAAAG, CUCAAAUUUG, UACCUUCG, UAAUUUG, CAACUUUG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, AAUCCCG, UAAAG, CCUUCG, UUUG, AAUG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, AUAG, AACAAG, UACAG, AAAG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, AAAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, AUAAAUCCAUAG, AAUG, CUUG, CCUCG, UAAG, AAUACUG, CCAG, UAAG, CAUAAUG, UCUUG, ACCAAG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, CCUCG, CAAG, CACAAUCG, AUCCUG, AUUUG, UAAG, CAUAG, AAAG, CCAG, UUCUG, CAAAUCG, AUCG, AAAG, ACUAAUCG, AACCAUCUAG, UUCCUG, AUAG, UAUCAG, UAAAG, AAUG, AUUAG, UUCCG, AAAUG, ACCUUG, UAAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, UAAG, AACUG, AACCG, AACG, UUAAG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, ACAGCCG, CCAUG, AAUCCG, UAACAACUCACCG, AAUG, AACUAG, CCCUG, CUCAAG, UCAG, AUAUG, CCCUG, UCAG, CCUAG, UAAG, AACG, GCCUCUAG, CCUCUAG, AACUUUG, AAAG, UUCCACG, UCAACAG, AUCCUAAG, CUCCG, UUUCAAAG, AUUUUAUG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, CCCUG, CUUAUCACCCCG, UUUAUCCG, UCUUAUG, CCAG, CACCUUUG, CUCCG, CUUG, AAAAUCCACAG, UUUUCAUG, CCAG, AUAACCG, UCUCCAAG, AACAG, CCUCUAG, AUAG, AUAAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, CCUUG, UCAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, CCUUG, UCUCUUG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, CAUUG, UCAG, AAAG, CAAUG, CUCUG, AAUG, UCAAAG, AAAUUCAACCAAG, CCUCG, AAUG, AUUCCCACUG, AAACCACAG, CCAAG, AACG, CUUG, AAUCAG, AAAG, ACCCUG, CUUG, UUUG, ACAUUG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, AUCCG, ACAUUG, UCAG, UUUG, AUAACG, UCCUAAG, CUCAUG, AACAG, AAAUCUCCAG, AACAAAAG, UAAAAG, CCCCCUUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, ACAUUG, CUUUUUG, AAUUCG, UAAG, AUUG, AACG, ACAG, UUUUACCCUACUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, UCUG, AUCAG, CAUUG, CUACCAUCCG, AUUAUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUACG, AAUAAG, UCCUUG, AACCAUAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, ACUUAG, UACAACG, UAAG, CCUUG, UUACG, AUCUG, AUUAAG, CCUUUG, UCUG, AUUUG
1_3Sce_18S_rRNA19.7952011_16, 17_20, 31_34, 43_48, 49_53AUCCUG, CCAG, CUUG, AUUAAG, CCAUG
1_223Sce_18S_rRNA18.33634939_942, 943_948, 949_953, 973_976, 977_980, 988_991, 998_1002AAAG, CAUUUG, CCAAG, AACG, AAAG, AUCG, AUCAG
1_327Sce_18S_rRNA16.924141300_1304, 1305_1308, 1319_1324, 1325_1328AUUUG, UCUG, AUAACG, AACG
1_111Sce_18S_rRNA14.62639499_503, 504_509, 511_514, 554_557, 558_561, 565_568UCUUG, UAAUUG, AAUG, CAAG, UCUG, CCAG
1_69Sce_18S_rRNA11.70315358_362, 366_371, 378_383UAACG, AAUAAG, AUUCCG
1_394Sce_18S_rRNA11.205311543_1546, 1549_1553, 1585_1588, 1591_1594, 1602_1605AUAG, CAUUG, UAAG, CAAG, CUUG
1_363Sce_18S_rRNA9.96281449_1453, 1456_1462UUCUG, CCGCACG
1_302Sce_18S_rRNA9.67251230_1233, 1234_1237, 1238_1241AUUG, ACAG, AUUG
1_167Sce_18S_rRNA9.5826715_720, 724_729UCCUUG, CUCUUG
1_417Sce_18S_rRNA9.29231655_1658, 1659_1662AUUG, AAUG
1_211Sce_18S_rRNA8.9226880_885, 896_899CAUCAG, UCAG
1_353Sce_18S_rRNA5.512111413_1416, 1430_1433UUUG, UCUG

Oligonucleotide-RNA matrix

MS/MS ion search
Matched nucleotide list(overall)