Ariadne: Results view


Search parameter
Nucleotide mapping

Score histgram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)


Search parameter

mgf_file: 141203_c25S_5dU_50f_spice11_20160712.mgf
database: S_cerevisiae/rRNA
Enzyme_pattern_file: RNaseT1.txt

max_mods: 0
max_missed_cleavages: 2
fp: 5pP
tp: OH3p
Mass_tolerance: 5
MS2_tolerance: 20
mass_table: 5D_CU
base_number: 3
reject_length_for_mapping: 3

more


Nucleotide mapping

Score histgram


Identification summary
RNA desc score matched sum matched_positions matched_sequences
2_1 Sce_25S_rRNA 356.43 174 1713 2_5, 6_17, 25_30, 42_53, 60_64, 65_74, 77_80, 81_86, 87_91, 105_110, 111_120, 129_136, 149_155, 163_170, 177_183, 184_189, 190_196, 198_202, 221_227, 252_256, 259_264, 278_281, 284_287, 291_297, 305_320, 321_330, 342_345, 348_353, 354_358, 365_368, 372_376, 377_383, 384_388, 395_400, 407_412, 416_419, 427_432, 433_437, 446_450, 453_459, 460_466, 477_483, 484_493, 496_499, 500_505, 506_510, 519_530, 532_535, 539_542, 543_547, 549_552, 569_575, 576_579, 601_604, 618_624, 640_644, 653_658, 669_674, 681_684, 689_701, 709_712, 715_718, 729_733, 734_737, 743_750, 755_760, 775_779, 782_785, 788_792, 806_809, 839_842, 871_875, 881_887, 888_891, 913_916, 917_924, 925_934, 942_947, 965_968, 979_984, 995_999, 1002_1005, 1006_1010, 1014_1018, 1025_1029, 1030_1035, 1060_1063, 1067_1072, 1073_1083, 1084_1087, 1091_1097, 1098_1101, 1128_1131, 1135_1139, 1153_1157, 1158_1161, 1167_1171, 1179_1186, 1187_1194, 1195_1206, 1214_1222, 1223_1226, 1223_1229, 1238_1242, 1251_1256, 1269_1281, 1286_1289, 1290_1295, 1296_1300, 1314_1319, 1341_1344, 1350_1354, 1358_1362, 1384_1387, 1396_1400, 1405_1408, 1418_1421, 1422_1429, 1423_1429, 1467_1473, 1489_1492, 1494_1500, 1501_1507, 1529_1536, 1548_1552, 1553_1560, 1566_1573, 1578_1586, 1587_1590, 1593_1598, 1600_1604, 1605_1610, 1619_1623, 1625_1634, 1636_1640, 1647_1650, 1669_1673, 1701_1712, 1720_1727, 1737_1743, 1755_1758, 1759_1766, 1771_1775, 1781_1784, 1797_1807, 1818_1825, 1826_1829, 1839_1845, 1853_1860, 1864_1868, 1869_1875, 1879_1882, 1893_1897, 1915_1919, 1920_1927, 1930_1934, 1936_1939, 1941_1947, 1964_1968, 1970_1973, 1988_1991, 1999_2002, 2009_2012, 2013_2017, 2026_2033, 2038_2042, 2053_2057, 2063_2069, 2080_2083, 2084_2095, 2096_2105, 2106_2110, 2117_2121, 2151_2155, 2162_2165, 2166_2169, 2181_2185, 2202_2206, 2207_2210, 2211_2216, 2222_2234, 2284_2288, 2312_2315, 2326_2335, 2356_2364, 2365_2369, 2372_2375, 2378_2381, 2386_2391, 2397_2400, 2404_2409, 2415_2418, 2426_2429, 2430_2435, 2458_2463, 2478_2481, 2484_2503, 2504_2522, 2535_2549, 2550_2555, 2556_2563, 2565_2573, 2580_2584, 2593_2598, 2599_2602, 2611_2614, 2625_2632, 2640_2645, 2652_2658, 2664_2669, 2673_2677, 2678_2687, 2691_2698, 2701_2706, 2707_2714, 2746_2749, 2755_2761, 2762_2770, 2771_2777, 2797_2800, 2801_2805, 2806_2814, 2817_2823, 2825_2828, 2851_2856, 2857_2863, 2902_2907, 2909_2912, 2919_2922, 2940_2943, 2969_2972, 2978_2990, 2994_2997, 2998_3003, 3004_3009, 3010_3015, 3016_3022, 3032_3036, 3037_3044, 3046_3052, 3054_3059, 3066_3069, 3070_3074, 3076_3080, 3089_3098, 3103_3108, 3113_3116, 3117_3124, 3125_3128, 3129_3136, 3141_3144, 3150_3158, 3178_3182, 3183_3188, 3192_3197, 3209_3216, 3225_3229, 3233_3238, 3243_3246, 3248_3252, 3257_3260, 3272_3276, 3277_3284, 3292_3303, 3310_3315, 3319_3325, 3334_3337, 3349_3353, 3357_3361, 3362_3366, 3372_3377, 3378_3383, 3387_3390, 3391_3395 UUUG, ACCUCAAAUCAG, UACCCG, CAUAUCAAUAAG, AAAAG, AAACCAACCG, AUUG, CCUUAG, UAACG, CAAAAG, CUCAAAUUUG, UACCUUCG, UAAUUUG, CAACUUUG, UUCCUUG, UCUAUG, UUCCUUG, AACAG, AAUCCCG, UAAAG, CCUUCG, UUUG, AAUG, CUCUAAG, UAAAUUCCAUCUAAAG, CUAAAUAUUG, AUAG, AACAAG, UACAG, AAAG, AAAAG, AACUUUG, AAAAG, AAAAAG, AAAUUG, AAAG, CAUUUG, AUCAG, UUUUG, CCCUCUG, CUCCUUG, AAUCUCG, CAUUUCACUG, CCAG, CAUCAG, UUUUG, AUAAAUCCAUAG, AAUG, CUUG, CCUCG, UAAG, AAUACUG, CCAG, UAAG, CAUAAUG, UCUUG, ACCAAG, UCUAUG, UUUG, UAAAACCCAUACG, AAAG, AACG, CCUCG, CAAG, CACAAUCG, AUCCUG, AUUUG, UAAG, CAUAG, AAAG, CCAG, UUCUG, CAAAUCG, AUCG, AAAG, ACUAAUCG, AACCAUCUAG, UUCCUG, AUAG, UAUCAG, UAAAG, AAUG, AUUAG, UUCCG, AAAUG, ACCUUG, UAAG, UCCUUG, UUACUUAAUUG, AACG, ACAUUUG, AAUG, UAAG, AACUG, AACCG, AACG, UUAAG, AAUACACG, CUCAUCAG, ACACCACAAAAG, UUCAUCUAG, ACAG, ACAGCCG, CCAUG, AAUCCG, UAACAACUCACCG, AAUG, AACUAG, CCCUG, CUCAAG, UCAG, AUAUG, CCCUG, UCAG, CCUAG, UAAG, AACG, GCCUCUAG, CCUCUAG, AACUUUG, AAAG, UUCCACG, UCAACAG, AUCCUAAG, CUCCG, UUUCAAAG, AUUUUAUG, CCACCAUCG, AAAG, AAUCCG, UUAAG, AUUCCG, AUAUG, AUUCUUCACG, UAACG, AAUG, CCCUG, CUUAUCACCCCG, UUUAUCCG, UCUUAUG, CCAG, CACCUUUG, CUCCG, CUUG, AAAAUCCACAG, UUUUCAUG, CCAG, AUAACCG, UCUCCAAG, AACAG, CCUCUAG, AUAG, AUAAG, AUCCG, UAACUUCG, AUAAG, AUUG, CUCUAAG, CCUUG, UCAG, CUUG, CUUG, CUUG, CUCUG, ACUACUUG, CCUUG, CCUUG, UCUCUUG, CUUG, CUACAAUUAACG, AUCAACUUAG, AACUG, ACAAG, CAUUG, UCAG, AAAG, CAAUG, CUCUG, AAUG, UCAAAG, AAAUUCAACCAAG, CCUCG, AAUG, AUUCCCACUG, AAACCACAG, CCAAG, AACG, CUUG, AAUCAG, AAAG, ACCCUG, CUUG, UUUG, ACAUUG, AAUAAG, CCAG, AAAUACCACUACCUUUAUAG, UUUCUUUACUUAUUCAAUG, AAUUCAUUUUCCACG, UUCUAG, CAUUCAAG, UCCCAUUCG, AUCCG, ACAUUG, UCAG, UUUG, CACAUCUG, AUAACG, UCCUAAG, CUCAUG, AACAG, AAAUCUCCAG, AACAAAAG, UAAAAG, CCCCCUUG, AAAG, CCUAUCG, AUCCUUUAG, UCCCUCG, CCAG, AAAAG, UUACCACAG, AUAACUG, CUUG, ACAUUG, CUUUUUG, AAUUCG, UAAG, AUUG, AACG, ACAG, UUUUACCCUACUG, AAUG, UUACCG, CAAUAG, UAAUUG, AACUUAG, AACAG, UUCAUUCG, AUAAUUG, UUUUUG, UCUG, AUCAG, CAUUG, CUACCAUCCG, AUUAUG, AACG, CCUCUAAG, UCAG, AAUCCAUG, AACG, AUUUCUUUG, AUACG, AAUAAG, UCCUUG, AACCAUAG, CAACG, CACUUG, AAAG, CCUUG, CUUG, CAAUG, UCAUUUUG, AUAAAUCAUUUG, ACUUAG, UACAACG, UAAG, CCUUG, UUACG, AUCUG, AUUAAG, CCUUUG, UCUG, AUUUG
1_3 Sce_18S_rRNA 19.79 5 20 11_16, 17_20, 31_34, 43_48, 49_53 AUCCUG, CCAG, CUUG, AUUAAG, CCAUG
1_223 Sce_18S_rRNA 18.33 6 34 939_942, 943_948, 949_953, 973_976, 977_980, 988_991, 998_1002 AAAG, CAUUUG, CCAAG, AACG, AAAG, AUCG, AUCAG
1_327 Sce_18S_rRNA 16.92 4 14 1300_1304, 1305_1308, 1319_1324, 1325_1328 AUUUG, UCUG, AUAACG, AACG
1_111 Sce_18S_rRNA 14.62 6 39 499_503, 504_509, 511_514, 554_557, 558_561, 565_568 UCUUG, UAAUUG, AAUG, CAAG, UCUG, CCAG
1_69 Sce_18S_rRNA 11.70 3 15 358_362, 366_371, 378_383 UAACG, AAUAAG, AUUCCG
1_394 Sce_18S_rRNA 11.20 5 31 1543_1546, 1549_1553, 1585_1588, 1591_1594, 1602_1605 AUAG, CAUUG, UAAG, CAAG, CUUG
1_363 Sce_18S_rRNA 9.96 2 8 1449_1453, 1456_1462 UUCUG, CCGCACG
1_302 Sce_18S_rRNA 9.67 2 5 1230_1233, 1234_1237, 1238_1241 AUUG, ACAG, AUUG
1_167 Sce_18S_rRNA 9.58 2 6 715_720, 724_729 UCCUUG, CUCUUG
1_417 Sce_18S_rRNA 9.29 2 3 1655_1658, 1659_1662 AUUG, AAUG
1_211 Sce_18S_rRNA 8.92 2 6 880_885, 896_899 CAUCAG, UCAG
1_426 Sce_18S_rRNA 6.34 1 1 1681_1685 AUCUG
1_145 Sce_18S_rRNA 5.93 1 1 635_641 AACUUUG
1_247 Sce_18S_rRNA 5.93 1 1 1043_1046 AUCG
1_262 Sce_18S_rRNA 5.93 1 1 1103_1107 UUCUG
1_339 Sce_18S_rRNA 5.93 1 1 1359_1364 CAUUUG
1_383 Sce_18S_rRNA 5.93 1 1 1508_1512 UCUUG
1_272 Sce_18S_rRNA 5.65 1 1 1123_1126 CAAG
1_353 Sce_18S_rRNA 5.51 2 11 1413_1416, 1430_1433 UUUG, UCUG
1_23 Sce_18S_rRNA 5.24 1 1 124_127 AUAG
1_48 Sce_18S_rRNA 5.24 1 1 275_279 CCUUG
1_61 Sce_18S_rRNA 5.24 1 1 331_334 AUAG
1_192 Sce_18S_rRNA 5.09 1 1 820_823 UUUG
1_374 Sce_18S_rRNA 4.73 1 1 1481_1484 CCAG
1_18 Sce_18S_rRNA 4.55 1 1 92_95 AAUG

Oligonucleotide-RNA matrix
  RNA 2_1 1_3 1_223 1_327 1_111 1_69 1_394 1_363 1_302 1_167 1_417 1_211 1_426 1_145 1_247 1_262 1_339 1_383 1_272 1_353 1_23 1_48 1_61 1_192 1_374 1_18
  rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 14 14 14 14 19 20 21 21 21 24 25 26
  score 356.43 19.79 18.33 16.92 14.62 11.70 11.20 9.96 9.67 9.58 9.29 8.92 6.34 5.93 5.93 5.93 5.93 5.93 5.65 5.51 5.24 5.24 5.24 5.09 4.73 4.55
  length 3394 43 64 29 70 26 63 14 12 15 8 20 5 7 4 5 6 5 4 21 4 5 4 4 4 4
oligonucleotide q#                                                    
CCAG 16 7 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
CUUG 1,517 10 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAUG 100 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUG 66 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAAG 148 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACG 12 8 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUG 73 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
AUCG 122 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
AUCAG 7 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAG 4 11 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCAAG 105 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUG 52 2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
AUAACG 113 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUG 83 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAG 158 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
AAUG 9 9 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
UCUUG 71 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
UAAUUG 97 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACG 34 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUAAG 60 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCG 87 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAG 54 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0
CAUUG 314 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAG 2 8 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUG 108 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
AUUG 50 3 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAG 65 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUUG 18,303 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAG 15 6 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUCAG 99 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCUG 181 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUUG 62 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
UUUG 17 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
CCUUG 5,246 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
AAAAAG 133 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCUUG 75 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUG 24 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCG 72 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUG 112 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAUCAG 186 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCUCG 104,365 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAG 179 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCAACUUAG 171 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAG 41 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAACCCAUACG 235 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUACCCUACUG 217 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAUCCACAG 192 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUACCACUACCUUUAUAG 340,547,622 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAUAG 88 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACCAUCCG 146 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCUCG 119,379,450 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCCAUAG 189,437 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCG 163 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUAUG 33 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAAG 118 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCG 29 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCAAAG 226 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUCUG 137 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAG 106 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCUUCG 202 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUUUUG 152 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCUG 354 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUG 57 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAAUUUG 182 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAG 47 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUUG 93 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUACUUG 177 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUG 30,357 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUAUCG 95 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUCUCCAG 239 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCAACCG 257,396,457 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCCCACUG 147 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAAAG 214,315,435 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCAAG 183 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACCG 164 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCACCAUCG 204,278 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAUUUG 59 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUCAACCAAG 211,436,533,571,583 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUAG 238,308 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCCUG 127 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAACG 151 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACCCG 126 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUAAG 223 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAG 89 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCG 194 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAUUUUG 213 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAUUG 8,232 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUUCACUG 166 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCUUG 101,377,426 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUCUAG 219 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACG 103 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUUAUG 91 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAGCCG 110 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACG 139 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAAUCG 200 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUCAAAUCAG 236 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAACUUUG 121,265 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUCUUCACG 169 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUCUUUG 220 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAUG 46 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUAG 116 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUG 175 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
GCCUCUAG 201,286 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAAG 124 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUUCAAG 234 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACUUCG 187,277 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAAUCAUUUG 199,459 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUUG 82 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAUUG 299 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUG 69 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACUG 35,321 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCUCCAAG 173 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCAG 134 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UACAG 107 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAACAACUCACCG 245 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUCUUUACUUAUUCAAUG 316 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAACAG 84 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCAUUCG 197,285 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCUUG 43 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUAAG 20 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUAAAUAUUG 190 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAAUG 196,229 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUACAAUUAACG 215 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACCUUG 76 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUUAUCACCCCG 198 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACCAUCUAG 79,312,522 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUUCAUUUUCCACG 263,424,473,528,626,632 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUAAG 26,267 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUAG 138 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCCCCUUG 221,291,463 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACACCACAAAAG 247 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCUAAG 195 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAG 25,259 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAACCACAG 241 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAUUG 159 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAAAUCG 132 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACUUAAUUG 172 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCCACG 86 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUUG 70 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACUUG 98 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCUAAG 267 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAAAG 22 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUUCAUG 191 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCCG 40,419,567 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUUCG 125,449 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCCCAUUCG 174 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACAAG 154 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACAAG 144 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACCUUUG 162,268 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUACG 131 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUUUAUG 184 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCAAG 90 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAACUG 140 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCACAG 252,279 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUUAUCCG 176 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CACAUCUG 68 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUUAG 53 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUACCG 123 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCCG 160 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUACACG 203,297 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAUCAG 85 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUUAUG 115 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CAUAUCAAUAAG 218,505 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AACUUAG 165 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UAAAUUCCAUCUAAAG 334,400 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCG 39 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UCAAAG 78 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUAAG 58 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCCUUUAG 207 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UUCUAG 145 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCUCG 44,369 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AAUCCAUG 224,302 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUG 37,375 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ACUAAUCG 228 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CCGCACG 155 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
CUCUUG 303 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0


MS/MS ion search

Matched nucleotide list(overall)
E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science