Ariadne: Results view

search> search log> results view


Search parameter
Nucleotide mapping

Score histgram

Identification summary

Oligonucleotide-RNA matrix

MS/MS ion search

Matched nucleotide list(overall)


Search parameter

mgf_file: 131106hela-miRNA12-27_spice11.mgf
database: H_sapiens/miRNA_var
Enzyme_pattern_file: noEnzyme.txt

max_mods: 0
max_missed_cleavages: 0
fp: 5pP
tp: OH3p
Mass_tolerance: 5
MS2_tolerance: 20
mass_table: default
base_number: 3
reject_length_for_mapping: 5

more


Nucleotide mapping

Score histgram


Identification summary
RNA desc score matched sum matched_positions matched_sequences
134_0 hsa-let-7a-5p M 9.78 1 1 1_22 UGAGGUAGUAGGUUGUAUAGUU
268_0 hsa-let-7d-5p M 9.78 1 1 1_22 AGAGGUAGUAGGUUGCAUAGUU
285_0 hsa-let-7f-5p M 9.78 1 1 1_22 UGAGGUAGUAGAUUGUAUAGUU
626_0 hsa-miR-365a-3p 9.78 1 1 1_22 UAAUGCCCCUAAAAAUCCUUAU
2193_0 hsa-miR-106b-5p 9.78 1 1 1_21 UAAAGUGCUGACAGUGCAGAU
3153_0 hsa-miR-4477a M 9.78 1 1 1_22 UGCUAUUAAGGACAUUUGUGAU
4921_0 hsa-miR-21-5p M 9.78 1 1 1_23 UAGCUUAUCAGACUGAUGUUGAC
6000_0 hsa-miR-548ap-3 9.78 1 1 1_22 ACAAAAACCACAAUUACUUUUG
16713_0 hsa-miR-16-5p M 9.78 1 1 1_22 UAGCAGCACGUAAAUAUUGGCG
19875_0 hsa-miR-23a-3p 9.78 1 1 1_22 AUCACAUUGCCAGGGAUUUCCA
26122_0 hsa-miR-98-5p M 9.78 1 1 1_22 UGAGGUAGUAAGUUGUAUUGUU
26484_0 hsa-miR-29b-3p 9.78 1 1 1_23 UAGCACCAUUUGAAAUCAGUGUU
26506_0 hsa-miR-23a-3p 9.78 1 1 1_23 AUCACAUUGCCAGGGAUUUCCAA
29232_0 hsa-miR-21-5p M 9.78 1 1 1_22 UAGCUUAUCAGACUGAUGUUGA
38548_0 hsa-miR-15b-5p 9.78 1 1 1_22 UAGCAGCACAUCAUGGUUUACA
49115_0 hsa-miR-29c-3p 9.78 1 1 1_22 UAGCACCAUUUGAAAUCGGUUA
52075_0 hsa-miR-30c-5p 9.78 1 1 1_24 UGUAAACAUCCUACACUCUCAGCU
5400_0 hsa-miR-10a-5p 9.09 1 1 1_22 AUACCCUGUAGAUCCGAAUUUG
12770_0 hsa-miR-660-5p 9.09 1 1 1_22 AUACCCAUUGCAUAUCGGAGUU

Oligonucleotide-RNA matrix
  RNA 134_0 268_0 285_0 626_0 2193_0 3153_0 4921_0 6000_0 16713_0 19875_0 26122_0 26484_0 26506_0 29232_0 38548_0 49115_0 52075_0 5400_0 12770_0
  rank 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 18 18
  score 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.78 9.09 9.09
  length 22 22 22 22 21 22 23 22 22 22 22 23 23 22 22 22 24 22 22
oligonucleotide q#                                      
AUCACAUUGCCAGGGAUUUCCAA 183 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
UAGCAGCACAUCAUGGUUUACA 83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
UAGCACCAUUUGAAAUCAGUGUU 214 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
UAGCUUAUCAGACUGAUGUUGAC 16 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
UAGCACCAUUUGAAAUCGGUUA 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
UAAUGCCCCUAAAAAUCCUUAU 94 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AGAGGUAGUAGGUUGCAUAGUU 128 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UGUAAACAUCCUACACUCUCAGCU 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
UAAAGUGCUGACAGUGCAGAU 114 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UGAGGUAGUAAGUUGUAUUGUU 199 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
UGCUAUUAAGGACAUUUGUGAU 113 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
UAGCAGCACGUAAAUAUUGGCG 64 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
UGAGGUAGUAGAUUGUAUAGUU 29 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
UGAGGUAGUAGGUUGUAUAGUU 11 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
AUCACAUUGCCAGGGAUUUCCA 76 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
ACAAAAACCACAAUUACUUUUG 127 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
UAGCUUAUCAGACUGAUGUUGA 17 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
AUACCCAUUGCAUAUCGGAGUU 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
AUACCCUGUAGAUCCGAAUUUG 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0


MS/MS ion search

Matched nucleotide list(overall)
E-mail to the administrator
© Biomolecular Characterization Unit,
RIKEN Center for Sustainable Resource Science